Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3267007
End position: 3267062
Length: 56

DNA sequence
>NC_005126, from 3267007 to 3267062 (56 bp); Photorhabdus luminescens ATGGATTTAGAACAAGCTATTGATTTAGAAAAAACTATTGATTTAGAAAAAACTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3267008-3267367	Sequence	plu2756 celC PTS system, cellobiose-specific IIA component (EIIA-CEL) (cellobiose-permease IIA component) (phosphotransferase enzyme II, A component) (EIII-CEL)