Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2698164
End position: 2698218
Length: 55

DNA sequence
>NC_005126, from 2698164 to 2698218 (55 bp); Photorhabdus luminescens GCATGGTTTTGTAGCTCGGCATGGTTTTGTAACTCGGCATGGTTTTGTAACTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2697600-2698610	Sequence	plu2296 - hypothetical protein (Protein is coded in complementary strand; from 2698610 to 2697600)