Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2037683
End position: 2037736
Length: 54

DNA sequence
>NC_005126, from 2037683 to 2037736 (54 bp); Photorhabdus luminescens GTTTCTGCATTGTTTTTGGTTTCTGCAATGTGTTTGATTTTTGCATTGCTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2036552-2038036	Sequence	plu1706 - hypothetical protein (Protein is coded in complementary strand; from 2038036 to 2036552)