Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3089419
End position: 3089468
Length: 50

DNA sequence
>NC_005126, from 3089419 to 3089468 (50 bp); Photorhabdus luminescens CCTCCTGTTCCACCGCCTGTTCCACCACCTGTTCCACCACCTGTTCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3089356-3089829	Sequence	plu2639 - hypothetical protein (Protein is coded in complementary strand; from 3089829 to 3089356)