Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4958909
End position: 4958957
Length: 49

DNA sequence
>NC_005126, from 4958909 to 4958957 (49 bp); Photorhabdus luminescens TTTACCTTCCTCTCGACCTTCCTCTCGACCTTCCTCTCGACCTTCCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4958808-4959818	Sequence	plu4237 - hypothetical protein (Protein is coded in complementary strand; from 4959818 to 4958808)