Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 205840
End position: 205888
Length: 49

DNA sequence
>NC_005126, from 205840 to 205888 (49 bp); Photorhabdus luminescens AGTAATACGTTATTAGTAATACATTTTTAGTAATACATTTTTAGTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 205881-206456	Sequence	plu0198 - DNA uptake protein (Protein is coded in complementary strand; from 206456 to 205881)