Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3201813
End position: 3201860
Length: 48

DNA sequence
>NC_005126, from 3201813 to 3201860 (48 bp); Photorhabdus luminescens CTCTAGTACAATGATCTTTTAGTACAATGATCTTTTAGTACAATGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3200953-3201819	Sequence	plu2699 manZ PTS system mannose-specific transporter subunit IID