Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2032314
End position: 2032361
Length: 48

DNA sequence
>NC_005126, from 2032314 to 2032361 (48 bp); Photorhabdus luminescens TATCGGCTAATACTTTGTTGGTTAATACTTTATTGGCTAGTGCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2031878-2032369	Sequence	plu1700 - hypothetical protein (Protein is coded in complementary strand; from 2032369 to 2031878)