Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4474982
End position: 4475028
Length: 47

DNA sequence
>NC_005126, from 4474982 to 4475028 (47 bp); Photorhabdus luminescens AAAATTACCATTTACAGCATCACCATTTACAGCATCACCATTTACAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4474391-4475488	Sequence	plu3808 purK phosphoribosylaminoimidazole carboxylase ATPase subunit