Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3877024
End position: 3877070
Length: 47

DNA sequence
>NC_005126, from 3877024 to 3877070 (47 bp); Photorhabdus luminescens CAACACTATTGCCTTCACCCCCATTGCCTTCAACCCGATTGTCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3865127-3880777	Sequence	plu3263 - hypothetical protein (Protein is coded in complementary strand; from 3880777 to 3865127)