Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2946077
End position: 2946123
Length: 47

DNA sequence
>NC_005126, from 2946077 to 2946123 (47 bp); Photorhabdus luminescens TATTTTTTCTACTGATGTTTTTTCTACTGATGTTTTTTCTACTGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2945181-2946173	Sequence	plu2501 galU UTP-glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 2946173 to 2945181)