Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 247677
End position: 247722
Length: 46

DNA sequence
>NC_005126, from 247677 to 247722 (46 bp); Photorhabdus luminescens GGTATTGTATTTGTAGGTGTTGTATTTGCGGGTACGGTATTTATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 247464-248936	Sequence	plu0235 glnG nitrogen regulation protein NR(I) (Protein is coded in complementary strand; from 248936 to 247464)