Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2235797
End position: 2235842
Length: 46

DNA sequence
>NC_005126, from 2235797 to 2235842 (46 bp); Photorhabdus luminescens GTCCTTTTCAATACTGTTCTTTTCAATACTATCTTTTTCAACACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2226516-2238998	Sequence	plu1880 - hypothetical protein (Protein is coded in complementary strand; from 2238998 to 2226516)