Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 748518
End position: 748562
Length: 45

DNA sequence
>NC_005126, from 748518 to 748562 (45 bp); Photorhabdus luminescens GTTGTTGTGATGGTAATTGCTGTGATGGAAATTGTTGTGATGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 747365-748618	Sequence	plu0651 csdA cysteine sulfinate desulfinase (Protein is coded in complementary strand; from 748618 to 747365)