Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4126356
End position: 4126400
Length: 45

DNA sequence
>NC_005126, from 4126356 to 4126400 (45 bp); Photorhabdus luminescens GATTGATTTAAATGATATTGTTTTAAATAATATTGTTTTAAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4123984-4126407	Sequence	plu3527 - hypothetical protein (Protein is coded in complementary strand; from 4126407 to 4123984)