Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2119970
End position: 2120014
Length: 45

DNA sequence
>NC_005126, from 2119970 to 2120014 (45 bp); Photorhabdus luminescens CTTGGTTATCGCTATATTGGTTATCACTATATTGGTTATTACTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2119585-2120118	Sequence	plu1776 sulA SOS cell division inhibitor (Protein is coded in complementary strand; from 2120118 to 2119585)