Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 1988267
End position: 1988311
Length: 45

DNA sequence
>NC_005126, from 1988267 to 1988311 (45 bp); Photorhabdus luminescens TACGATTGTTTTTAGCATGATTCTTTTTAGCATGATTGTTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1987183-1988418	Sequence	plu1664 - hypothetical protein (Protein is coded in complementary strand; from 1988418 to 1987183)