Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 1974999
End position: 1975043
Length: 45

DNA sequence
>NC_005126, from 1974999 to 1975043 (45 bp); Photorhabdus luminescens GATTTAATGGGATATTGTTTAATGGAATATTGTTTAATGGAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1973894-1975858	Sequence	plu1654 - hypothetical protein (Protein is coded in complementary strand; from 1975858 to 1973894)