Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2633872
End position: 2633914
Length: 43

DNA sequence
>NC_005126, from 2633872 to 2633914 (43 bp); Photorhabdus luminescens GAAAGTACTAAATCGAAAGTGCTAAATCGAAAGTGCTAAATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2633894-2634871	Sequence	plu2239 - hypothetical protein (Protein is coded in complementary strand; from 2634871 to 2633894)