Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2040856
End position: 2040898
Length: 43

DNA sequence
>NC_005126, from 2040856 to 2040898 (43 bp); Photorhabdus luminescens CCTTGCTCAATACCTTGCTCAATACCTTGCTCAATGCCTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2040655-2041677	Sequence	plu1711 - hypothetical protein (Protein is coded in complementary strand; from 2041677 to 2040655)