Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2053710
End position: 2053747
Length: 38

DNA sequence
>NC_005126, from 2053710 to 2053747 (38 bp); Photorhabdus luminescens TGTAATTGTTCTTGTTCTTGTTCTTGTTCTTGTTCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2051310-2054216	Sequence	plu1719 - hypothetical protein (Protein is coded in complementary strand; from 2054216 to 2051310)