Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2000340
End position: 2000377
Length: 38

DNA sequence
>NC_005126, from 2000340 to 2000377 (38 bp); Photorhabdus luminescens TTGTGATTGTGATTGTGATTGTGATTGTGATTGTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1999006-2000685	Sequence	plu1676 - hypothetical protein (Protein is coded in complementary strand; from 2000685 to 1999006)