Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3715014
End position: 3715050
Length: 37

DNA sequence
>NC_005126, from 3715014 to 3715050 (37 bp); Photorhabdus luminescens TTATTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3715011-3715535	Sequence	plu3155 - hypothetical protein (Protein is coded in complementary strand; from 3715535 to 3715011)