Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 1992357
End position: 1992393
Length: 37

DNA sequence
>NC_005126, from 1992357 to 1992393 (37 bp); Photorhabdus luminescens GACGTCCTTCCTGACGCCCTTCTTGGCGTCCTTCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1992245-1993171	Sequence	plu1669 - hypothetical protein (Protein is coded in complementary strand; from 1993171 to 1992245)