Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 1005405
End position: 1005441
Length: 37

DNA sequence
>NC_005126, from 1005405 to 1005441 (37 bp); Photorhabdus luminescens AAAAAAAAGATAAAAAAACAAAAAAAAATAAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1004903-1005448	Sequence	plu0879 cpmK CpmK protein (Protein is coded in complementary strand; from 1005448 to 1004903)