Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 5045974
End position: 5046009
Length: 36

DNA sequence
>NC_005126, from 5045974 to 5046009 (36 bp); Photorhabdus luminescens GAGCTTACCGCTAAGCTTACCGCTGAGCTTACCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5045519-5046616	Sequence	plu4320 hsdS Type I restriction enzyme specificity protein HsdS