Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3715016
End position: 3715051
Length: 36

DNA sequence
>NC_005126, from 3715016 to 3715051 (36 bp); Photorhabdus luminescens ATTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3715011-3715535	Sequence	plu3155 - hypothetical protein (Protein is coded in complementary strand; from 3715535 to 3715011)