Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3285721
End position: 3285753
Length: 33

DNA sequence
>NC_005126, from 3285721 to 3285753 (33 bp); Photorhabdus luminescens ATATCATAAATATCATAAATATCATAAATATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3285487-3286494	Sequence	plu2772 - hypothetical protein (Protein is coded in complementary strand; from 3286494 to 3285487)