Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4822833
End position: 4822864
Length: 32

DNA sequence
>NC_005126, from 4822833 to 4822864 (32 bp); Photorhabdus luminescens CCGCCCATACCGCCCATGCCACCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4822824-4824470	Sequence	plu4134 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 4824470 to 4822824)