Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4460070
End position: 4460100
Length: 31

DNA sequence
>NC_005126, from 4460070 to 4460100 (31 bp); Photorhabdus luminescens TTCATTTCATTCATTTCACTCATTTCATTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4459644-4460093	Sequence	plu3795 - hypothetical protein (Protein is coded in complementary strand; from 4460093 to 4459644)