Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 1852844
End position: 1852872
Length: 29

DNA sequence
>NC_005126, from 1852844 to 1852872 (29 bp); Photorhabdus luminescens TTTCTCTTGTTTCTCTTGTTTCTGTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1852842-1853279	Sequence	plu1549 - hypothetical protein (Protein is coded in complementary strand; from 1853279 to 1852842)