Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 5303310
End position: 5303337
Length: 28

DNA sequence
>NC_005126, from 5303310 to 5303337 (28 bp); Photorhabdus luminescens AACATCCCCACCATCCCCACCATCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5302270-5303445	Sequence	plu4540 obgE GTPase ObgE (Protein is coded in complementary strand; from 5303445 to 5302270)