Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 5282274
End position: 5282300
Length: 27

DNA sequence
>NC_005126, from 5282274 to 5282300 (27 bp); Photorhabdus luminescens TGCACGACCTGCACGACCTGCACGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5281393-5283312	Sequence	plu4523 deaD ATP-dependent RNA helicase DeaD (Protein is coded in complementary strand; from 5283312 to 5281393)