Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 5179993
End position: 5180019
Length: 27

DNA sequence
>NC_005126, from 5179993 to 5180019 (27 bp); Photorhabdus luminescens CTCTCTCTCATCTCTCTCATCTCTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5180019-5181581	Sequence	plu4430 - hypothetical protein (Protein is coded in complementary strand; from 5181581 to 5180019)