Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4406068
End position: 4406094
Length: 27

DNA sequence
>NC_005126, from 4406068 to 4406094 (27 bp); Photorhabdus luminescens AAACAGAATCAGCAACAGATACAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4405167-4406237	Sequence	plu3736 - hypothetical protein (Protein is coded in complementary strand; from 4406237 to 4405167)