Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4194277
End position: 4194303
Length: 27

DNA sequence
>NC_005126, from 4194277 to 4194303 (27 bp); Photorhabdus luminescens TTTACTATCTTTACCATCTTTACCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4193684-4194979	Sequence	plu3560 - hypothetical protein (Protein is coded in complementary strand; from 4194979 to 4193684)