Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 4192080
End position: 4192106
Length: 27

DNA sequence
>NC_005126, from 4192080 to 4192106 (27 bp); Photorhabdus luminescens TCCTCCATTTCCACCATTCCCTCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4191700-4193004	Sequence	plu3558 - hypothetical protein (Protein is coded in complementary strand; from 4193004 to 4191700)