Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 3996064
End position: 3996088
Length: 25

DNA sequence
>NC_005126, from 3996064 to 3996088 (25 bp); Photorhabdus luminescens TAATTTCATTTAAATTATTTGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3996000-3996848	Sequence	plu3368 - hypothetical protein (Protein is coded in complementary strand; from 3996848 to 3996000)