Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2498247
End position: 2498271
Length: 25

DNA sequence
>NC_005126, from 2498247 to 2498271 (25 bp); Photorhabdus luminescens AACATGAAGATGACCATGAACATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2497848-2498795	Sequence	plu2115 znuA high-affinity zinc transporter periplasmic component