Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2309361
End position: 2309385
Length: 25

DNA sequence
>NC_005126, from 2309361 to 2309385 (25 bp); Photorhabdus luminescens GCTGGTTTTCTGGTTTTCTGGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2308489-2309817	Sequence	plu1943 fliK flagellar hook-length control protein FliK (Protein is coded in complementary strand; from 2309817 to 2308489)