Sequence retrieval

Genome: Photorhabdus luminescens
Start position: 2232579
End position: 2232602
Length: 24

DNA sequence
>NC_005126, from 2232579 to 2232602 (24 bp); Photorhabdus luminescens ATTGGTATTGCTGTTGGTATTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2226516-2238998	Sequence	plu1880 - hypothetical protein (Protein is coded in complementary strand; from 2238998 to 2226516)