Sequence retrieval

Genome: Chlamydophila pneumonie TW-183
Start position: 718448
End position: 718473
Length: 26

DNA sequence
>NC_005043, from 718448 to 718473 (26 bp); Chlamydophila pneumonie TW-183 AGAACAAAAACAAAAACAAGAGCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 717806-719179	Sequence	CpB0655 secY preprotein translocase subunit SecY (Protein is coded in complementary strand; from 719179 to 717806)