Sequence retrieval

Genome: Chlamydophila pneumonie TW-183
Start position: 547135
End position: 547158
Length: 24

DNA sequence
>NC_005043, from 547135 to 547158 (24 bp); Chlamydophila pneumonie TW-183 CATCTATATCTACATCCACATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 547125-548858	Sequence	CpB0493 - hypothetical protein (Protein is coded in complementary strand; from 548858 to 547125)