Sequence retrieval

Genome: Chlamydophila pneumonie TW-183
Start position: 251633
End position: 251657
Length: 25

DNA sequence
>NC_005043, from 251633 to 251657 (25 bp); Chlamydophila pneumonie TW-183 GAAAACAGAAAACAGAAAACAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 251521-251679	Sequence	CpB0217 - hypothetical protein (Protein is coded in complementary strand; from 251679 to 251521)