Sequence retrieval

Genome: Pirellula sp.
Start position: 6919729
End position: 6919770
Length: 42

DNA sequence
>NC_005027, from 6919729 to 6919770 (42 bp); Pirellula sp. GAGCTAGAAGCTAGAAGCTAGAAGCTAGAAGCTAGAAGCTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6919361-6919729	Sequence	RB12827 - signal peptide (Protein is coded in complementary strand; from 6919729 to 6919361)