Sequence retrieval

Genome: Pirellula sp.
Start position: 6876577
End position: 6876600
Length: 24

DNA sequence
>NC_005027, from 6876577 to 6876600 (24 bp); Pirellula sp. TTTACAATTTGCAATTTTCAATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6876167-6876916	Sequence	RB12759 - hypothetical protein (Protein is coded in complementary strand; from 6876916 to 6876167)