Sequence retrieval

Genome: Pirellula sp.
Start position: 6867184
End position: 6867208
Length: 25

DNA sequence
>NC_005027, from 6867184 to 6867208 (25 bp); Pirellula sp. TTGGGCTCGGGCTCGGGCTTGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6865612-6868329	Sequence	RB12741 - hypothetical protein (Protein is coded in complementary strand; from 6868329 to 6865612)