Sequence retrieval

Genome: Pirellula sp.
Start position: 6726223
End position: 6726269
Length: 47

DNA sequence
>NC_005027, from 6726223 to 6726269 (47 bp); Pirellula sp. CGAGCACGAGCACGAGCACGAGCACGAGCACGAGCACGAGCACGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6725922-6726260	Sequence	RB12492 - hypothetical protein (Protein is coded in complementary strand; from 6726260 to 6725922)