Sequence retrieval

Genome: Pirellula sp.
Start position: 5855477
End position: 5855506
Length: 30

DNA sequence
>NC_005027, from 5855477 to 5855506 (30 bp); Pirellula sp. CTCCGCGCTCTTCTGCGCTCTTCCGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5855472-5856872	Sequence	RB10783 - hypothetical protein (Protein is coded in complementary strand; from 5856872 to 5855472)