Sequence retrieval

Genome: Pirellula sp.
Start position: 5807297
End position: 5807337
Length: 41

DNA sequence
>NC_005027, from 5807297 to 5807337 (41 bp); Pirellula sp. ACGAGCACGAGCACGAGCACGAGCACGAGCACGAGCACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5805998-5807422	Sequence	RB10682 - signal peptide (Protein is coded in complementary strand; from 5807422 to 5805998)